
Lisää kirjoituksia netistä.

Etsi blogista

The Deadly Genomes

Päivitettiin 4. lokakuuta 2015 kello 04.17

Lepran, syfiliksen, sikainfluenssan, keltakuumeen ja muiden riiviäisten genomisarjat on julkaistu digitaalisessa muodossa. Nuo mainitsemani ja monet muut ovat olleet hypisteltävissä useamman vuoden ajan esimerkiksi The Deadly Genomes -sivustolta löytyvien linkkien takaa. Julkaisen nyt palan pernaruton lähdekoodia FASTA-formaatissa. Se kuuluu näin: ATATTTTTTCTTGTTTTTTATATCCACAAACTCTTTTCGTACTTTTA CACAGTATATCGTGTTGTGGACA.

Tietoa kirjoittajasta

"The Deadly Genomes" on saanut pisteet 7 yhteensä 10 pisteestä. Julkaisu on pisteytetty 1 kerran. Tämä juttu mukaan laskettuna blogissa on julkaistu yhteensä 1275 kirjoitusta. Tämän sivun niin sanottu kestolinkki on tässä siltä varalta jos haluat linkittää siihen esimerkiksi blogista tai joltain foorumilta. Tagi tai tagit: .

Tsekkaa myös minkälaisia valokuvia teen: www.pjti.fi