⚈ Kuopassa.net

Lisää kirjoituksia netistä.

The Deadly Genomes

Kirjoitettiin
Päivitettiin 4. lokakuuta 2015 kello 04.17

Lepran, syfiliksen, sikainfluenssan, keltakuumeen ja muiden riiviäisten genomisarjat on julkaistu digitaalisessa muodossa. Nuo mainitsemani ja monet muut ovat olleet hypisteltävissä useamman vuoden ajan esimerkiksi The Deadly Genomes -sivustolta löytyvien linkkien takaa. Julkaisen nyt palan pernaruton lähdekoodia FASTA-formaatissa. Se kuuluu näin: ATATTTTTTCTTGTTTTTTATATCCACAAACTCTTTTCGTACTTTTA CACAGTATATCGTGTTGTGGACA.

Tagit:

Tietoa kirjoittajasta